Skip to main navigation Skip to search Skip to main content

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: A comparison of biophysical techniques

  • Matthew W. Freyer
  • , Robert Buscaglia
  • , Binh Nguyen
  • , W. David Wilson
  • , Edwin A. Lewis

Research output: Contribution to journalArticlepeer-review

Abstract

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5′-d(CGAATTCGTCTCCGAATTCG)-3′. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K ∼ 108 M-1). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7 × 108 M-1 (ITC), K = 2.4 × 108 M-1 (DSC), and K = 2.9 × 108 M-1 (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 108 M-1. The ITC technique has the advantage of determining a full set of thermodynamic parameters, including ΔH, TΔS, and ΔCp in addition to ΔG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.

Original languageEnglish (US)
Pages (from-to)259-266
Number of pages8
JournalAnalytical Biochemistry
Volume355
Issue number2
DOIs
StatePublished - Aug 15 2006

Keywords

  • Biosensor-surface plasmon resonance
  • DAPI
  • DSC
  • Differential scanning calorimetry
  • Hairpin DNA
  • ITC
  • Isothermal titration calorimetry
  • Minor groove binding affinity
  • Netropsin
  • SPR
  • Thermodynamics

ASJC Scopus subject areas

  • Biophysics
  • Biochemistry
  • Molecular Biology
  • Cell Biology

Fingerprint

Dive into the research topics of 'Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: A comparison of biophysical techniques'. Together they form a unique fingerprint.

Cite this